General process:
1. Design sgRNA (chopchop or crispr.mit) according to the gene you want to study, and choose the appropriate Cas9 type according to your existing vector:
2. After synthesizing sgRNA, connect it to your sgRNA expression vector. Generally, you can choose 2-3 to test the efficiency;
3. According to your site-related information, select a homologous recombination arm sequence of about 40bp in length (for primer synthesis) at the sgRNA cut, which needs to have both left and right sides;
4. According to some existing cell vectors in your laboratory, find the vectors with neo and puro tags, find out the sequence, and design primers to amplify these two antibiotic tag fragments;
5. The company synthesizes antibiotic amplified fragments with homologous recombination arms, and uses the fragments in step 4 as a template to amplify tag fragments with homologous recombination arms;
6. Co-transfect Cas9 plasmid, sgRNA plasmid and two tag fragments, 48 hours later, drug screening, first round of drug screening with neo, 5 days after screening, add puro for double antibody screening, delete and select both neo and puro resistance Gene knockout cells;
7. Perform monoclonal identification of the obtained cells, and select the cell line that has biallelic editing at the gene locus you want to study.
If the entire experiment time is lucky enough, it can be compressed in one and a half months. CRISPR is a very common technology. Don’t be afraid, you can get rewards if you dare to think and do it.
Classic Case:
In January 2013, two American laboratories published a new method for gene knockout in cell lines based on CRISPR-Cas9 technology in the journal Science. This technology is different from previous technologies in that it uses target-specific RNA Bring the Cas9 nuclease to a specific target on the genome, thereby cutting a specific gene site and causing mutations. This technology was quickly applied to the construction of gene knockout mice and rat animal models. Through a series of studies, it was first proved that the introduction of the CRISPR-Cas system into mouse fertilized eggs by RNA injection is more effective in generating site-directed mutations in embryos than DNA injection. On this basis, it was discovered that this method has no restriction on mouse genetic strains, and can delete large fragments of genomic DNA. It can also be produced in the same mouse or rat by simultaneously injecting RNA sequences targeting different genes. The effect of multiple gene mutations. In addition, it also proved that the gene knockout rat model constructed using CRISPR-Cas technology has a consistent phenotype compared with the same gene (obesity-related G protein coupled receptor Mc4R) mutant rat constructed by the traditional method. The genetically mutant animals constructed by this method have significantly higher germline transfer ability than traditional methods, and it is a reliable, efficient and rapid new method for constructing knockout animal models.
CRISPR-Cas technology is the fourth method that can be used for site-specific construction of gene knockout large and mouse animals after zinc finger nuclease (ZFN), ES cell targeting, and TALEN. It is highly efficient, fast, and germline. The characteristics of strong transfer ability and simple economy will have very broad application prospects in animal model construction.
Materials required for CRISPR/Cas9
1) Plasmid: pSpCas9(BB)-2A-GFP (Addgene plasmid ID: 48138), used to transfect cas9, this plasmid contains Cas9 and GFP, the nickase activity of Cas9 will be used for the ko of the specific target gene, GFP can be used as Transfection label. pSpCas9(BB) (Addgene plasmid ID: 42230), if the sgRNA used in the experiment is the purified product of PCR amplification, the plasmid must be used as a template for U6. pUC19 (Invitrogen, cat.no.15364-011) can be used to construct sgRNA. If the PCR product is used for transfection, this plasmid is required for co-transfection and serves as a DNA carrier. For the above three plasmids, the sgRNA expression mode (PCR product/single vector system/dual vector system) is selected according to the experiment to determine which one to use.
2) Ultrapure water, DNase/RNase-free (Life Technologies, cat. no. 10977-023)
3) High-fidelity polymerase, Kapa HiFi (Kapa Biosystems), PfuUltra (Agilen), Herculase II fusion polymerase can be used, as long as the fidelity effect is good, the amplification process does not produce mutations.
4) Taq DNA polymerase with standard Taq buffer (NEB, cat. no. M0273S) is used for general detection.
5） QIAquick gel extraction kit (Qiagen, cat. no. 28704)
6） QIAprep spin miniprep kit (Qiagen, cat. no. 27106)
7) Fast Digest BbsI (BpiI) (Fermentas/Thermo Scientific, cat. no. FD1014), if you need to construct sgRNA into pSpCas9(BB)-2A-GFP plasmid, you need this enzyme.
8) T7 DNA ligase with 2× rapid ligation buffer (Enzymatics, cat. no. L602L). Or T4 DNA ligase, there is no difference between the two.
9） Stbl3 chemically competent E. coli (Life Technologies, cat. no. C7373-03)
10）dNTP solution mix, 25 mM each (Enzymatics, cat. no. N205L)
11） MgCl2, 25 mM (Thermo Scientific, cat. no. R0971)
12） T4 polynucleotide kinase (New England BioLabs, cat. no. M0201S)
13） Plasmid Safe ATP-dependent DNase (Epicentre, cat. no. E3101K)
14） Adenosine 5′-triphosphate, 10 mM (New England BioLabs, cat. no. P0756S)
15）SOC medium (New England BioLabs, cat. no. B9020S)
CRISPR/Cas9 operation process
1) Determine the target site. Design sgRNA according to the CRISPR online design tool http://crispr.mit.edu/ (there are other design tools, this software is recommended). Input the nucleotide sequence within 250bp of the target gene to avoid introns, and the candidate target site will be given in about 10 minutes. Or manual selection. The 20bp fragment upstream of the 5'-NGG (PAM) of the target region can be used as the target site. Generally, the target site can be selected in the sense strand or the antisense strand, either.
2) Prepare sgRNA expression system. Three options are available:
a. Directly use PCR to amplify the purified product, the product fragment contains U6+sgRNA, about 370bp;
b. Construct the sgRNA vector into the pSpCas9(BB)-2A-GFPpUC19 plasmid, which is a single vector system;
c, sgRNA vector is constructed to the structure
3) Built into pUC19 to become a dual vector system.
a. PCR amplification of sgRNA expression structure.
The PCR system is as follows: U6-Fwd: GAGGGCCTATTTCCCATGATTCC U6-Rev: AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAcNNNNNNNNNNNNNNNNNNNCCGGTGTTTCGTCCTTTCCACAAG (recommended to use the reverse-complementary polymerase of the target site) or the fragment that can be used as a reverse-complementary polymerase. pSpCas9(BB).
The PCR reaction conditions are as follows: The procedure is fixed and it is not recommended to change it.
After PCR, it was verified by 2% agarose gel electrophoresis, 5ul PCR product, 15 V cm-1, 30 minutes. The band position is 370bp.
The PCR product is purified with QIAquick PCR purification kit, according to the kit instructions, and finally 35ul EB buffer or water is used for recovery.
b. Construction of sgRNA vector-single vector system (pSpCas9(BB)-2A-GFP). First, determine the target site according to the aforementioned method, and design the sgRNA Oligo to be inserted according to the target site.
Generally speaking, the form of sgRNA oligo is as follows:
sgRNA top: CACCgNNNNNNNNNNNNNNNNNNNN sgRNA bottom: AAACNNNNNNNNNNNNNNNNNNNc Two designed oligos need to be phosphorylated and annealed into a double strand. The system is as follows: The procedure is as follows: 37 °C 30 min; 95 °C 5 min; reduce 5 °C every minute to 25 °C. After the end, dilute with water according to 1:200 (1ul oligo+199 H2O). Secondly, insert the synthesized sgRNA oligo into the target vector. This experiment will use pSpCas9(BB)-2A-GFP. The ligation reaction system is as follows: Among them, pSpCas9(BB)-2A-GFP 100ng, adjust the volume according to the concentration.
Connect for 1hr. Design a control, the control is the same as above, but no oligo is added.
The ligation reaction conditions are as follows: After the ligation reaction is completed, it is recommended to use PlasmidSafe exonuclease to remove linear DNA residues. This step is optional, but it is strongly recommended. 37 °C 30 min, 70 °C 30 min. After that, it can be stored at -20°C for at least one week.
The product after this step can be directly used to transform E. coli, and Stbl3 competent is recommended. Take the heat shock method: take 2ul PlasmidSafe plasmid and add it to 20ul competent, place it on ice for 10min, heat shock at 42°C, 30s, immediately place it on ice for 2min, add 100ul SOC, and directly coat the plate. A LB plate containing Amp100 was used. 37°C overnight. Observation on the next day, the control plate should have no clones, but the plate containing sgRNA inserts should have clones. Pick out monoclonal shake bacteria, and use QIAprep spin miniprep kit for plasmid extraction. Use U6-Fwd primer as the sequencing primer for sequencing.
c. sgRNA dual-vector expression system (constructed into pUC19) If pUC19 is used to establish a dual-vector expression system, first of all refer to the previous method to find the target site, and design primers to amplify U6+sgRNA scafford; Fwd primers need to contain EcoRI, Rev The primer must contain HindIII restriction site. Then perform operations such as restriction digestion and connection. The digestion system is as follows: U6+sgRNA PCR product digestion pUC19 plasmid digestion product purification, using QIAQuick PCR purification kit, after purification can be stored at -20 °C. Ligation: Connect the digested plasmid and PCR product in a ratio of 1:3 at room temperature for 15 minutes. After the ligation reaction is complete, it is recommended to use PlasmidSafe exonuclease to remove linear DNA residues. (Optional) Subsequent transformation of Escherichia coli, heat shock transformation, plate coating, single colony selection, bacterial shaking, plasmid extraction, and sequencing detection.
Of course, if you have any questions, you can discuss it together in the next live broadcast on March 2, 2021!
