statement
This article is about studying GB-T 42821-2023 Diagnostic Methods for Nanoparticle Disease in Shellfish Packages. The study notes are compiled and shared in the hope that more people will benefit. If there is any infringement, please contact us in time
242 g
57.1 mL
100 mL
1000 mL
A.9 1× electrophoresis buffer
50× electrophoresis buffer
Add water to bring to volume
Store at room temperature.
A.10 Preparation method of hematoxylin dye solution
Hematoxylin
Anhydrous ethanol
Potassium aluminum sulfate
distilled water
mercury oxide
Glacial acetic acid
20 mL
1000 mL
1g
10 mL
20 g
200 mL 0.5 g
8 mL
Dissolve hematoxylin in absolute ethanol, and heat and dissolve potassium aluminum sulfate in distilled water. Then mix the two liquids and boil, add mercury oxide, and continue adding
Heat and stir until the solution turns dark purple, immediately cool with ice water, return to room temperature, then filter and set aside.
A.11 Preparation of eosin dye solution
Choose water-soluble eosin. The formula is: 1g of eosin, 100 mL of 70% to 75% alcohol.
Use a little distilled water to make a paste of eosin, then
add alcohol and stir while adding until it is completely dissolved. At this time, the reagent is a little turbid. Take 0.1 mL.
Glacial acetic acid, added to the reagent, the reagent gradually transforms
It is clear and bright red.
A.12 Preparation of blue-returning liquid
Take 5 mL of ammonia hydroxide and add it to 1000 mL of distilled water.
A.13 Paraffin section preparation
A.13.1 Tissue dehydration, transparency, wax immersion, embedding, and sectioning
Collect the material and fix it for 24 hours, trim the tissue block, change the fixative and re-fix it for 12 hours, rinse with tap water for 24 hours, 70% ethanol for 1 hour, 85% ethanol for 1 hour, 95
% ethanol for 45 minutes twice, absolute ethanol for 30 minutes three times, xylene 30
min, xylene 5 min～20 min 2 times, add paraffin
1h~1.5h2 times, then embedded, trimmed, sliced, unfolded, mounted, and baked.
A.13.2 Hydration, staining, washing, dehydration, counterstaining and mounting of sections
xylene for 10 minutes twice
, then pass through absolute ethanol, absolute ethanol, 95% ethanol, 85% ethanol, and 70% ethanol for 2
minutes each, and then
GB/T 42821—2023
After passing through distilled water for 3 minutes, stain with hematoxylin for 5 minutes to 20 minutes, wash with tap water for 3 minutes, 1% hydrochloric acid alcohol for 8
seconds to 15 seconds, wash with tap water for 3 minutes, return to blue solution for 2 minutes to 5 minutes, wash with tap water for 5 minutes, distilled water 5
minutes, then pass through 50% ethanol, 70% ethanol, and 80% ethanol for 3 minutes each for
dehydration, counterstain with 0.5% eosin stain for 1 minute to 2 minutes, and
then pass through 95% ethanol, 95% ethanol, and absolute ethanol in sequence. ,
Dehydrate twice with absolute ethanol for 2 minutes each, clear with xylene twice for 2 minutes, and finally seal with sealing gum.
GB/T 42821—2023
Appendix B
(informative)
Shellfish nanamiosis
B.1 Disease description
Bonamiasis is a disease of aquatic animals caused by Bonamia ostreae, Bonamia
exitiosa and other
parasites in the host's blood cells or free in connective tissue, gills, viscera or mantle. A blood protozoal disease that is a serious and dangerous
The main disease that harms the world's shellfish aquaculture industry is also a
quarantine shellfish parasitic disease specified by the World Organization for Animal Health (WOAH).
B.2 Pathogen
There are five species of Bonamia found today. In addition to
Bonamia ostreae, which is mainly parasitic in the European flat oyster (Ostrea edulis), there is also Bonamia ostreae
, which is parasitic in the Sydney rock oyster (Saccostrea
glomerata). Bonamia roughleyi,
Bonamia exitiosa in Ostrea edulis, Bonamia perspora in Crassostrea ariakensis, Bonamia perspora
in Crassostrea ariakensis
, Bonamia perspora in Australian oyster Bonamia sp.
in Ostrea an- gasi.
The pathogen has strong infectivity, and the suspension containing the pathogen is contagious. It can infect oysters
after being positioned in the host cells for 30 minutes.
Among them, the pathogen in granular blood cells has the strongest infectivity. causing widespread danger
The main causes of damage are oyster bag nanoworms and oyster-killing nanoworms.
B.3 Susceptible host
Susceptible hosts include European oyster (Ostrea edulis), Angasi oyster (Ostrea
angasi), Parsi oyster (Ostrea puel-chana), Chilean oyster (Ostrea
chilensis), Omi oyster (Crassostrea ariakensis), Chilean oyster (Tiostrea)
chilensis)
Waiting for shellfish.
B.4 Clinical symptoms
Oysters infected with cystanomiasis usually present with bivalve incomplete closure, and in severe cases, gill filament damage or death, but this symptom may also be caused by
Caused by other diseases, symptoms cannot be used to determine whether you are infected with nanamiasis. Mild cases have no obvious symptoms.
B.5Geographic distribution
The disease is mainly distributed in Denmark, the Netherlands, France, Ireland, the United Kingdom, Italy, Spain, and the United States.
Deaths caused by oyster nanoparticles infecting European flat oysters have been reported in Europe and South America . In the past decade or so, the prevalence of oyster bag nanoparticle disease has tended to ease. Although no
major , it does occur from time to time in the United States, the United Kingdom, Ireland, Canada and other places, with the prevalence ranging from a few tenths to a hundred percent. The score ranges from thirty to forty.
There are currently no reports of the occurrence of cystomycosis in aquatic animals in my country.
B.6 Organization print inspection
Nanoworms are spherical or oval in shape, with a body size of 2 μm to 5 μm. The nucleus is
red-stained and the cytoplasm is blue-stained. They mostly parasitize in cells.
Nanoworms are shown at the location indicated by the arrow in Figure B.1.
GB/T 42821—2023
Figure B.1 Nanoworms in tissue cells
B.7 Hemolymph print examination
Under the microscope, it can be observed that the parasites are parasitic in hemolymphocytes and are spherical or oval in shape, with a size of 2 μm to 5 μm.
Giemsa stain
After staining, the nuclei were stained red and the cytoplasm was stained blue. Nanoworms are shown at the location indicated by the arrow in Figure B.2.
Figure B.2 Nanoworm in oyster blood
B.8 Histopathological examination
The nanoworms are spherical or oval in shape, with body size ranging from 2 μm to 5 μm. The
nuclei are red-stained and the cytoplasm is blue-stained. Pack nanoworms are shown in Figure B.3
The location pointed by the arrow in the middle.
GB/T 42821—2023
Figure B.3 Observation of nanoworms in oyster paraffin sections
GB/T 42821—2023
Appendix C
(informative)
Target amplification sequence and the location of primers and probes
C.1 PCR target amplification sequence and primer position of Bonamia ostreae (3 0 bp)
CATTTAATTGGTCGGGCCGCTGGTCCT GATCCTTTACTTTGAGAAAATTAAAGTGCTCAAA
Bon F
GCAGGCTCGCGCCTGAATGCATTAGCATGG'AATAATAAGACACGACTTCGGC|GCICGCCT |CGGC
G
GTTGTTTTGTTGGTTTTGAGCTGGAGTAATGATTGATAGAAACAATTGGGGGTGCTAGTA
TCGCCGGGCCAGAGGTAAAATTCTTTAATTCCGGTGAGACTAACTTATGCGAAAGCATTC
ACCAAGCGTGTTTTCTTTAATCAAGAACTAAAGTT GGGGGATCGAAGACGATCAG
Bon R
Note: The GGCGCC in italics and underline is the Hae II enzyme cleavage site, the GCGCCCTCGGC in the "mouth"
is the Bgl I enzyme cleavage site, and "|" indicates the enzyme cleavage position of the enzyme cleavage site. The PCR amplification products of specific primers Bon F
and Bon R were analyzed by Hae Ⅱ and Bgl I enzyme digestion, Bonamia os-
treae, Bonamia exitiosa and Bonamia perspora were digested by restriction endonuclease Hae II
to 115 bp and 189 bp; Bonamia
ostreae was digested by the restriction endonuclease BglI to 120 bp and 180 bp. Bonamia exitiosa and
Bonamia perspora could not be digested by the enzyme.
cut to determine its species.
C.2 PCR target amplification sequence and primer position of Bonamia exitiosa (3 0 4
bp)
CATTTAATTGGTCGGGCCGCTGGTCCT GATCCTTTACTTTGAGAAAATTAAAGTGCTC
Bon F
AAAGCAGGCTCGCGCCTGAATGCATTAGCATGGAATAATAAGACACGACTTCGGCGC|CGC
CTTCCGTGGC GGTTGTTTTGTTGGTTTTGAGCTGGAGTAATGATTGATAGAAACAATTGG
GGGTGCTAGTATCGCCGGGCCAGAGGTAAAATTCTTTAATTCCGGTGAGACTAACTTATG
CGAAAGCATTCACCAAGCGTGTTTTCTTTAATCAAGAACTAAAGTT GGGGGATCGAAGACGATCAG
Bon R
C.3 Target amplification sequence and primer probe position of fluorescent PCR (9 2 bp)
GAGCTGGAGTAATGATTGATAGAAACAATTG
GGGGTGCTAGTATCGCCGGGCCAGAGGTA
Bon qF Bon qP
AAAT TCTTTAATTCCGGTGAGACTAACTTATG
Good qR
Further reading
More information can be found in GB-T 42821-2023 Diagnostic Methods for Nanoplasia in Shellfish Bags. Further study